Alternaria Leaf Spot of Lentil in the Steppe Zone of North Kazakhstan: Species Complex Identification and Field Efficacy of Chemical and Biological Fungicides

Field studies were conducted in 2023-2025 with the aim of optimizing the phytosanitary state of lentil crops in the steppe zone of North Kazakhstan (Akmola region, Shortandy district, SPCGF named after A. I. Barayev LLP). In the course of research, the phytopathogenic fungus Alternaria alternata, the causative agent of alternariosis, was detected.

The materials for the research were samples of mycelium of Alternaria fungi isolated from the affected organs of lentil plants. Laboratory phytopathological studies were carried out in specialized laboratories of the Department of Plant Protection and Quarantine of S. Seifullin Kazakh Agro-Technical University and in the plant protection laboratories of the SPCGF named after A. I. Barayev, LLP.

Samples were collected from one experimental location by three replicated field blocks, at three growth stages: bud development, flowering, and seed maturation. The sampling dates were June 28, July 17, and August 15 in 2023; June 27, July 16, and August 14 in 2024; and June 30, July 18, and August 18 in 2025.

On each sampling date‚ 30 plants per plot were examined‚ and for laboratory isolation‚ 15 to 20 symptomatic plants were collected from each treatment on diagonal transects․ Sampled plant organs with signs of Alternaria infection were leaves (approximately 45%)‚ stems (25%)‚ pods (20%), and seeds (10%)․

The symptomatic pieces were washed‚ cut into 5 to 7 mm long pieces‚ and sterilized by immersion in 70% ethanol for 30 s‚ and 1% sodium hypochlorite for 1 to 2 min․ They were then rinsed three times in sterile distilled water‚ dried on sterile filter paper‚ placed in potato-glucose agar medium‚ and incubated at 24 to 25 ℃ for 7 days and a light/dark cycle of 12 h/12 h․ Putatively Alternaria-like colonies were cultured on fresh media‚ establishing pure cultures that were identified using morphological and molecular techniques․

Molecular identification of the Alternaria alternata fungus on the basis of ITS nucleotide sequences was carried out in the National Center of Biotechnology of the Ministry of Education and Science of the Republic of Kazakhstan.

DNA was isolated from fungal isolates using the hexadecyltrimethylammonium bromide (CTAB) method. 500 μl of TES buffer was added to the samples (0.1-0.2 g) and left to incubate at 37 ℃ overnight. After the incubation, 100 μl of 5 M NaCl was added and mixed, followed by adding 65 μl of 10% CTAB with NaCl preheated to 65 ℃, mixing thoroughly, and incubating for 10 minutes at 65 ℃. After 3 minutes of centrifugation at 13.000 g (to prevent CTAB from cooling), the supernatant was transferred to new tubes. An equal volume of chloroform: isoamyl alcohol (24:1) was added to the supernatant, mixed, and left at 4 ℃ for 20 minutes. Centrifugation was performed for 5 min at 13.000g, after which the aqueous (upper) phase was collected without touching the precipitate and transferred to a clean tube. An equal volume of chloroform: isoamyl alcohol (24:1) was added and mixed thoroughly until a uniform emulsion was formed. Centrifugation was performed for another 3 minutes, and the aqueous phase was transferred to a clean tube. Cooled isopropanol (0.6 of the volume) was added, mixed by tipping, and left for 20 min at -20 ℃. After 5 min of centrifugation at 13.000 g, the supernatant was removed. The DNA precipitate was washed with 70% ethanol, dried, dissolved in 50 μl TE buffer, and stored at -20 ℃.

DNA concentration was measured by spectrophotometry with a NanoDrop 1000 spectrophotometer at 260 nm (UV region) and 280 nm (DNA protein component).

2.1 Amplification of the Internal Transcribed Spacer fragment

The polymerase chain reaction (PCR) reaction was performed with universal primers ITS5 - ggaagtaaaagtcgtaacaagg and ITS4 - tcctccgcttattgatatgc in a total volume of 30 µL per reaction according to the following mix: 5 μL DNA template‚ 1 U Taq DNA polymerase (ThermoFisher)‚ 0․2 mM each dNTP‚ 10 × KCl buffer (ThermoFisher)‚ 2․5 mM MgCl₂ and 10 pmol each primer․ The PCR amplification program was as follows: 94 ℃ for 5 min followed by 30 cycles of 95 ℃ for 30 sec‚ 55 ℃ for 40 sec and 72 ℃ for 50 sec‚ followed by a final elongation step at 72 ℃ for 7 min․ PCR was performed on an Applied Biosystems Simpli Amp Thermal Cycler.

PCR product cleanup was performed by the enzymatic method using Exonuclease I (Fermentas) and alkaline phosphatase (Shrimp Alkaline Phosphatase, Fermentas). The sequencing reaction was performed using a BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) as per the manufacturer's instructions, followed by fragment separation using an automatic genetic analyzer 3730xl DNA Analyzer (Applied Biosystems).

MEGA 11 software was used for phylogenetic analysis․ The nucleotide sequence alignment was done using ClustalW, and the phylogenetic tree was constructed using the NJ method․ The distances between the taxa were calculated using the Kimura 2-parameter model‚ while gaps and missing data were treated as pairwise deletion․ A bootstrap analysis of 1000 replicates was also conducted to assess the robustness of the tree.

Reference ITS sequences of closely related Alternaria species were retrieved from GenBank and included in the analysis. The reference sequences used for tree construction were MZ066739.1 for Alternaria alternata and MN593338.1 for Alternaria tenuissima. Additional reference sequences of closely related Alternaria species were also included to clarify the phylogenetic position of the studied isolate.

The electrophoresis of the amplified products was performed in 1.5% agarose gel in 1× TAE buffer.

The gel filling procedure consisted of adding 1.5 grams of agarose and 8 µL of ethidium bromide to 100 mL of 1× TAE buffer. Electrophoresis was performed under 120 V for 40 minutes [15, 16].

2.2 Determining the development and spread of diseases

Throughout the growing season, lentils were regularly monitored in the field for the development of diseases. At each stage of vegetation, symptoms of plant damage were recorded, and samples with signs of infection with fungi of the genus Alternaria were collected.

Disease monitoring in the field relied on two parameters: disease prevalence, or the number of affected plants in crops, and disease progression, or the degree of organ damage. The prevalence of diseases (P) was calculated by formula (1):

$P=\frac{n \times 100}{N}$                           (1)

where,

P – disease prevalence, %; n – number of organs with evidence of disease in the sample; N – total number of analyzed organs in the sample.

Disease progression (R) and average damage to individual organs in percent were determined by formula (2):

$R=\frac{\sum(a \times b)}{N \times K} \times 100$                       (2)

where,

R – disease progression, %; ∑(a × b) – sum of the products of the number of affected organs and their corresponding severity scores; N – the total number of analyzed organs in the sample; K – the highest scale score. To ensure better accuracy, researchers used specialized scales characterizing the intensity of development of a particular disease.

Disease severity was assessed using a visual scale from 0 to 5. It was based on the proportion of the affected organ surface area of the lentil:

0 – no visible symptoms;

1 – single small necrotic or chlorotic spots, up to 5% of the organ surface affected;

2 – several distinct spots, 6–10% of the organ surface affected;

3 – numerous spots with partial coalescence, 11–25% of the organ surface affected;

4 – large coalesced lesions, 26–50% of the organ surface affected;

5 – severe damage with extensive necrosis, deformation, drying of the organ, or more than 50% of the organ surface affected.

In the calculation of disease progression (R), K was therefore equal to 5. The same scale was applied to leaves, stems, pods, and seeds, with visual assessment adjusted to the affected organ.

The study determined the biological efficacy of fungicides during the vegetative stage of the crop.

The biological efficacy of fungicides was calculated using the modified Abbott's formula, comparing the prevalence of the disease before and after treatment:

$C=\frac{100(P-p)}{P}$                        (3)

where,

C – biological efficacy of the fungicide, %;

P – disease prevalence in the control variant;

p – disease prevalence in the experimental variant.

Following the identification and determination of lentil diseases, field studies were conducted at the experimental site of the Scientific and Production Center of Grain Farming named after A. I. Barayev, LLP, to identify effective drugs. The study tested the effects of the fungicide Kolosal Pro, microemulsion concentrate (m.e.c.) with the active substances propiconazole, 300 g/L + tebuconazole, 200 g/L, and the biofungicide Biograno Forte with active microorganisms Bacillus spp., Trichoderma spp., in comparison with a treatment-free variant (control).

The treatments were applied once at the bud development stage of the lentil. The application dates were June 28, 2023, June 27, 2024, and June 30, 2025. Spraying was carried out using a hand-held plot sprayer equipped with flat-fan nozzles. The spray volume was 300 L/ha, the working pressure was 0.25–0.30 MPa, and the travel speed was approximately 4–5 km/h. No adjuvants were used. In this experiment, Biograno Forte was applied once, at the same growth stage as Kolosal Pro, to ensure direct comparison between the biological and chemical treatments.

The field experiment was arranged as a randomized complete block design (RCBD) with three replications. Each replication represented one block, and the three treatments were randomly allocated within each block to reduce the influence of spatial heterogeneity, including possible soil fertility and moisture gradients across the experimental field. The size of the plot was 4.2 m × 25 m = 105 m² (see Table 1). The total number of experimental plots was nine. Buffer strips of at least 1.0 m were maintained between plots and blocks to reduce spray drift and cross-contamination between treatments. The sowing date was May 20. The seeds were sown at a rate of 2.5 million germinating seeds per hectare and embedded at a depth of 4-5 cm. The preceding crop was wheat on fallow. In spring, once the soil reached its physical ripeness, it was harrowed with a Catros disk harrow to a depth of 4-5 cm. Harvesting was carried out using standard agricultural combines when the lentils ripened, depending on weather conditions.

Statistical analysis was performed to evaluate the effects of year, treatment, and their interaction on disease progression (R) and disease prevalence (P). The data were analyzed using two-way analysis of variance (ANOVA), with year and treatment as fixed factors. When significant differences were detected, means were compared using Tukey’s test at p < 0.05. The results are presented as mean values based on three replications.

Table 1. Experiment design

2.3 Soil and climatic conditions during crop vegetation

The site of the Scientific and Production Center of Grain Farming named after A․ I․ Barayev‚ LLP is located on the territory of the Shortandy district of Akmola region of Kazakhstan․ The climate of the region is characterized by an average annual amount of precipitation of 250-280 mm and a growing season of 110-120 days․ It has a sharply continental arid climate‚ with hot summers and cold winters‚ with an important temperature difference between day and night․ Sunny weather is common‚ and the summer insolation is nearly as high as in the tropics; cloud cover is very low․ Annual precipitation decreases from north to south‚ with rainfall peaking in July and at its lowest in February.

The soil-climatic zone of the study area is steppe, with southern carbonate chernozems, medium loamy in grain size composition. Humus content is 3.4-3.6%, and soil pH is 7.0-7.2.

In the 2023 growing season, the weather conditions differed from the long-term average in the key meteorological parameters, primarily the amount of precipitation and temperatures. Total precipitation over the crop growing season from May to August inclusive was 38.1 mm, which is 120.2 mm below the long-term average for the same period. According to the hydrothermal coefficient, this growing season can be categorized as dry (Hydrothermal Coefficient (HTC) = 0.2).

The 2024 growing season experienced 309.1 mm of precipitation from May to August, which exceeds the long-term average value by 150.8 mm. In terms of moisture content, the year was favorable for plant growth and development and the formation of the lentil vegetative mass. The main bulk of precipitation fell in May (76.9 mm), July (63.3 mm), and especially August (106.6 mm), when the maximum monthly precipitation was recorded.

The 2025 growing season had a total of 82.9 mm of precipitation from May to August, which is 75.4 mm less than the long-term average for the same period. Based on the hydrothermal coefficient, the growing season was dry (HTC = 0.3) (see Figure 2).

The growing season of 2023 was characterized by elevated average monthly air temperatures compared with the long-term average. The average air temperature was 15.3 ℃ in May, 20 ℃ in June, 24.4 ℃ in July, and 19.7 ℃ in August. The greatest deviations were recorded in July and August, when the temperature exceeded the long-term average by 4.5 ℃ and 7.1 ℃, respectively. Combined with the precipitation deficit shown in Figure 2, these conditions indicate a dry and warm growing season.

In 2024, the highest average monthly air temperatures were recorded in June and July, reaching 22.6 ℃ and 21.7 ℃, respectively. May and August were cooler, with average temperatures of 11.2 ℃ and 12.7 ℃. Compared with the long-term average, June and July were warmer, whereas May and August were slightly cooler. Thus, the 2024 growing season was characterized by contrasting temperature conditions combined with increased precipitation (see Figure 3).

Thus, the prevailing weather conditions contributed to the rapid spread and development of diseases. Overall, the weather conditions during the crop growing season aggravated the phytosanitary condition of crops.

Species of the genus Alternaria are ubiquitous in agricultural landscapes and are primary causes of leaf spot in leguminous crops worldwide [2]. Beyond direct tissue damage, these pathogens are known to contaminate grain with mycotoxins, posing a health risk to humans and livestock [18]. Despite their significance, the complex taxonomy of the genus has historically hindered precise research [19]. By utilizing molecular phylogenetic analysis of the ITS rDNA sequence, this study confirmed the dominance of Alternaria alternata in the North Kazakhstan lentil pathocomplex, resolving traditional morphological ambiguities [17, 20].

The progression of alternariosis in our experiments was heavily dictated by seasonal meteorological variations. The 2024 growing season was characterized by exceptional moisture, with 318 mm of precipitation, which is a 140.6 mm increase over the long-term average. This high-moisture environment, particularly the heavy rainfall in August, catalyzed a sharp increase in disease prevalence, reaching 29.7% in the control group. In contrast, the drier 2023 season (HTC = 0.2) saw a significantly lower prevalence of 10.1%. These findings align with general epidemiological models suggesting that Alternaria spore germination and infection are optimized under high relative humidity and frequent rainfall events [21].

A key finding of this study is the differential response of chemical and biological fungicides to these fluctuating weather conditions. The chemical fungicide Kolosal Pro (propiconazole + tebuconazole) exhibited its peak efficacy in 2023 at 76.9% but saw a notable decrease to 65.8% in 2024. This reduction in efficacy under high rainfall is likely due to the "rainfastness" threshold of triazole-based fungicides. While systemic fungicides like tebuconazole are generally more resistant to wash-off than contact protectants, intense and frequent precipitation can still dilute surface residues and diminish the overall protective barrier before the active ingredients are fully absorbed or redistributed within the plant [22, 23]. Furthermore, the extreme disease pressure in 2024 likely challenged the curative capacity of the chemical treatment [24].

In contrast, the biofungicide Biograno Forte (Bacillus spp., Trichoderma spp.) appeared relatively more stable in its performance across the different years. While its absolute efficacy was lower than that of Kolosal Pro, its consistent ability to suppress disease (ranging from 55.6% in wet years to 69.4% in dry years) suggests a robust interaction with the environment. Biological agents such as Trichoderma and Bacillus are living organisms that can actively colonize the phyllosphere [25]. In moist years like 2024, the high humidity that favors Alternaria also supports the growth and antagonistic activity of these beneficial microbes, potentially compensating for the dilution effects seen in chemical residues [26, 27].

Ultimately, while Kolosal Pro remains the most effective short-term chemical option for managing Alternaria in lentils, its sensitivity to extreme precipitation highlights the need for integrated strategies [13, 28]. The stable performance of Biograno Forte indicates that biological controls could play a vital role in maintaining baseline protection, especially during prolonged wet periods when chemical persistence is compromised. These results provide a science-based foundation for regional crop protection, emphasizing that fungicide selection should consider both the identified pathogen complex and forecasted meteorological conditions.